Review



image lab 5 2 biorad laboratories imagequant  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad image lab 5 2 biorad laboratories imagequant
    Image Lab 5 2 Biorad Laboratories Imagequant, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36371 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/image+lab+5+2+biorad+laboratories+imagequant/Image+Lab+Software/pmc12557607__mmc1-18-101-104
    Average 99 stars, based on 36371 article reviews
    image lab 5 2 biorad laboratories imagequant - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Labeling:

    Article Title: The mitochondrial disulphide relay substrate FAM136A safeguards IMS proteostasis and cellular fitness
    Article Snippet: Oligonucleotides Company Identifier FAM136A Guide sgRNA2 Fw: CACCGTCCGGAAGATGCAGGTAGCG this study N/A FAM136A Guide sgRNA2 Rev: AAACCGCTACCTGCATCTTCCGGAC this study N/A FAM136A Guide sgRNAex1 Fw: CACCGACTCCACCGCCTCCTGCACC Rev: AAACGGTGCAGGAGGCGGTGGAGTC this study N/A FAM136A Guide sgRNAex2 Fw: CACCGCTGGTGCACCTGCTTCATGG Rev: AAACCCATGAAGCAGGTGCACCAGC this study N/A Non-targeting control sgRNA Fw: CACCGGTATGTCGGGAACCTCTCC Rev: AAACGGAGAGGTTCCCGACATACC this study N/A DELE1 Guide sgRNA Fw: CACCGAGCGACATGTGGCGCCTCCC Rev: AAACGGGAGGCGCCACATGTCGCTC (Fessler et al., 2020) N/A HRI Guide sgRNA Fw: CACCGCCATCGACTTTCCCGCCGA Rev: AAACTCGGCGGGAAAGTCGATGGC (Fessler et al., 2020) N/A siRNA target sequence TGCCAACATCCTGTTTACCAA Quiagen SI04228301 N/A siRNA target sequence TACCAGACTCTTCTTACTACA Quiagen SI04331789 N/A .. Company/ Source Identifier EasyTagTM Express Protein Labeling Mix, [35S] Perkin-Elmer Cat# NEG772 EasyTagTM Express Protein Labeling Mix, [35S] Revvity (Germany) GmbH NEG772002MC ROTI®Quant universal Carl Roth Cat # 0120.1 TnT Quick Coupled Transcription/Translation System Promega Cat# L1170 Pierce 660 nm Protein Assay Reagent Thermo Scientific Cat# 22660 Carbonylcyanid-3-chlorphenylhydrazon (CCCP) Sigma-Aldrich Cat# C2759 FuGENE HD Transfection Reagent Promega Cat# E2311 RosettaTM 2 (DE3) SinglesTM Competent Cells Novagen Cat# 70954-3 One Shot TOP10 Chemically Competent E. coli Thermo Fisher Cat# C404010 TMRM TCI chemicals Cat# 115532-50-8 Software and Algorithms Alpha-fold Multimer (Jumper et al., 2021) Pymol https://www.pymol.org Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Image Lab 5.2 Biorad Laboratories ImageQuant TL 8.1 GE Healthcare Life Sciences iMTS score (Boos et al., 2018) (http://iomiqsweb1.bio.uni-kl.de/). .. Graphpad Prism GraphPad Software, Boston, Massachusetts USA www.graphpad.com SUPPLEMENTAL FIGURES Supplemental Figure S1.

    Transfection:

    Article Title: The mitochondrial disulphide relay substrate FAM136A safeguards IMS proteostasis and cellular fitness
    Article Snippet: Oligonucleotides Company Identifier FAM136A Guide sgRNA2 Fw: CACCGTCCGGAAGATGCAGGTAGCG this study N/A FAM136A Guide sgRNA2 Rev: AAACCGCTACCTGCATCTTCCGGAC this study N/A FAM136A Guide sgRNAex1 Fw: CACCGACTCCACCGCCTCCTGCACC Rev: AAACGGTGCAGGAGGCGGTGGAGTC this study N/A FAM136A Guide sgRNAex2 Fw: CACCGCTGGTGCACCTGCTTCATGG Rev: AAACCCATGAAGCAGGTGCACCAGC this study N/A Non-targeting control sgRNA Fw: CACCGGTATGTCGGGAACCTCTCC Rev: AAACGGAGAGGTTCCCGACATACC this study N/A DELE1 Guide sgRNA Fw: CACCGAGCGACATGTGGCGCCTCCC Rev: AAACGGGAGGCGCCACATGTCGCTC (Fessler et al., 2020) N/A HRI Guide sgRNA Fw: CACCGCCATCGACTTTCCCGCCGA Rev: AAACTCGGCGGGAAAGTCGATGGC (Fessler et al., 2020) N/A siRNA target sequence TGCCAACATCCTGTTTACCAA Quiagen SI04228301 N/A siRNA target sequence TACCAGACTCTTCTTACTACA Quiagen SI04331789 N/A .. Company/ Source Identifier EasyTagTM Express Protein Labeling Mix, [35S] Perkin-Elmer Cat# NEG772 EasyTagTM Express Protein Labeling Mix, [35S] Revvity (Germany) GmbH NEG772002MC ROTI®Quant universal Carl Roth Cat # 0120.1 TnT Quick Coupled Transcription/Translation System Promega Cat# L1170 Pierce 660 nm Protein Assay Reagent Thermo Scientific Cat# 22660 Carbonylcyanid-3-chlorphenylhydrazon (CCCP) Sigma-Aldrich Cat# C2759 FuGENE HD Transfection Reagent Promega Cat# E2311 RosettaTM 2 (DE3) SinglesTM Competent Cells Novagen Cat# 70954-3 One Shot TOP10 Chemically Competent E. coli Thermo Fisher Cat# C404010 TMRM TCI chemicals Cat# 115532-50-8 Software and Algorithms Alpha-fold Multimer (Jumper et al., 2021) Pymol https://www.pymol.org Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Image Lab 5.2 Biorad Laboratories ImageQuant TL 8.1 GE Healthcare Life Sciences iMTS score (Boos et al., 2018) (http://iomiqsweb1.bio.uni-kl.de/). .. Graphpad Prism GraphPad Software, Boston, Massachusetts USA www.graphpad.com SUPPLEMENTAL FIGURES Supplemental Figure S1.

    Software:

    Article Title: The mitochondrial disulphide relay substrate FAM136A safeguards IMS proteostasis and cellular fitness
    Article Snippet: Oligonucleotides Company Identifier FAM136A Guide sgRNA2 Fw: CACCGTCCGGAAGATGCAGGTAGCG this study N/A FAM136A Guide sgRNA2 Rev: AAACCGCTACCTGCATCTTCCGGAC this study N/A FAM136A Guide sgRNAex1 Fw: CACCGACTCCACCGCCTCCTGCACC Rev: AAACGGTGCAGGAGGCGGTGGAGTC this study N/A FAM136A Guide sgRNAex2 Fw: CACCGCTGGTGCACCTGCTTCATGG Rev: AAACCCATGAAGCAGGTGCACCAGC this study N/A Non-targeting control sgRNA Fw: CACCGGTATGTCGGGAACCTCTCC Rev: AAACGGAGAGGTTCCCGACATACC this study N/A DELE1 Guide sgRNA Fw: CACCGAGCGACATGTGGCGCCTCCC Rev: AAACGGGAGGCGCCACATGTCGCTC (Fessler et al., 2020) N/A HRI Guide sgRNA Fw: CACCGCCATCGACTTTCCCGCCGA Rev: AAACTCGGCGGGAAAGTCGATGGC (Fessler et al., 2020) N/A siRNA target sequence TGCCAACATCCTGTTTACCAA Quiagen SI04228301 N/A siRNA target sequence TACCAGACTCTTCTTACTACA Quiagen SI04331789 N/A .. Company/ Source Identifier EasyTagTM Express Protein Labeling Mix, [35S] Perkin-Elmer Cat# NEG772 EasyTagTM Express Protein Labeling Mix, [35S] Revvity (Germany) GmbH NEG772002MC ROTI®Quant universal Carl Roth Cat # 0120.1 TnT Quick Coupled Transcription/Translation System Promega Cat# L1170 Pierce 660 nm Protein Assay Reagent Thermo Scientific Cat# 22660 Carbonylcyanid-3-chlorphenylhydrazon (CCCP) Sigma-Aldrich Cat# C2759 FuGENE HD Transfection Reagent Promega Cat# E2311 RosettaTM 2 (DE3) SinglesTM Competent Cells Novagen Cat# 70954-3 One Shot TOP10 Chemically Competent E. coli Thermo Fisher Cat# C404010 TMRM TCI chemicals Cat# 115532-50-8 Software and Algorithms Alpha-fold Multimer (Jumper et al., 2021) Pymol https://www.pymol.org Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Image Lab 5.2 Biorad Laboratories ImageQuant TL 8.1 GE Healthcare Life Sciences iMTS score (Boos et al., 2018) (http://iomiqsweb1.bio.uni-kl.de/). .. Graphpad Prism GraphPad Software, Boston, Massachusetts USA www.graphpad.com SUPPLEMENTAL FIGURES Supplemental Figure S1.



    Similar Products

    99
    Bio-Rad image lab 5 2 biorad laboratories imagequant
    Image Lab 5 2 Biorad Laboratories Imagequant, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/image+lab+5+2+biorad+laboratories+imagequant/Image+Lab+Software/pmc12557607__mmc1-18-101-104
    Average 99 stars, based on 1 article reviews
    image lab 5 2 biorad laboratories imagequant - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results